WormMine: Gene WBGene00131602

• WormBase Gene ID: WBGene00131602
• Gene Name: CJA12398
• Sequence Name: CJA12398
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: SXP/RAL-2 family protein Ani s 5-like, metal-binding domain and SXP/RAL-2 family protein Ani s 5-like, cation-binding domain. Is an ortholog of C. elegans ZK822.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12398.1	CJA12398.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12398	CJA12398		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070909
• Remark: CJA12398, CCTCGAAAACAGCAGCTTGAGCATTCAAGAGCAGAAGGAGGCGATTGAGGGACTCACAGA, WBGene00131602
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term