WormMine: Gene WBGene00136396

• WormBase Gene ID: WBGene00136396
• Gene Name: Cjp-vps-52
• Sequence Name: CJA17193
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Vps52 / Sac2 family and Vps52. Is an ortholog of C. elegans vps-52. In C. elegans, vps-52 is involved in negative regulation of dense core granule transport; positive regulation of dense core granule transport; and positive regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17193a.1	CJA17193a.1		[unknown]
Transcript:CJA17193b.1	CJA17193b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17193a	CJA17193a		[unknown]
CDS:CJA17193b	CJA17193b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074286
• Remark: Cjp-vps-52, GCCAGCGGTGGATAGTATCAACACTGAATGCATTCAACTTTTCGCCAACTTTAGCCTAGG, WBGene00136396
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term