WormMine: Gene WBGene00026298

• WormBase Gene ID: WBGene00026298
• Gene Name: CBG03431
• Sequence Name: CBG03431
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; DNA2/NAM7 helicase-like, C-terminal; and AAA domain. Is an ortholog of C. elegans ent-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03431a.1	CBG03431a.1		[unknown]
Transcript:CBG03431b.1	CBG03431b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03431a	CBG03431a		[unknown]
CDS:CBG03431b	CBG03431b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065367
• Remark: CBG03431, TGTGTCCATGTCAAGAGCCAAACAAGCTACAATCATTATTGGAAACGTGAATTCCCTCCG, WBGene00026298
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term