WormMine: Gene WBGene00054648

• WormBase Gene ID: WBGene00054648
• Gene Name: Cre-tmem-131
• Sequence Name: CRE25066
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin-like fold; Transmembrane protein 131-like N-terminal; Transmembrane protein 131-like; and Transmembrane protein 131-like, N-terminal. Is an ortholog of C. elegans tmem-131. In C. elegans, tmem-131 is involved in collagen biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25066.1	CRE25066.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25066	CRE25066		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098777
• Remark: CRE25066, AATTATATATGCATATGAACGGAAGTGCATGGTTGTTCCCATTAGCAGCTACTGTTCCTG, WBGene00054648
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term