WormMine: Gene WBGene00134389

• WormBase Gene ID: WBGene00134389
• Gene Name: CJA15185
• Sequence Name: CJA15185
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: SPRY domain-containing protein 7; Concanavalin A-like lectin/glucanase domain superfamily; B30.2/SPRY domain superfamily; and SPRY domain. Is an ortholog of C. elegans F18H3.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15185.1	CJA15185.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15185	CJA15185		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086802
• Remark: CJA15185, TCAAAAATTTCACGGAAGCGCCTCCAACTGGATATGGTGAAATTCTGGTGGAACAGACGA, WBGene00134389
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term