WormMine: Gene WBGene00034416

• WormBase Gene ID: WBGene00034416
• Gene Name: Cbr-lsy-13
• Sequence Name: CBG13684
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; Zinc finger, FYVE/PHD-type; Zinc finger, PHD-type; and ING family. Is an ortholog of C. elegans lsy-13. In C. elegans, lsy-13 is involved in cell fate specification; maintenance of left/right asymmetry; and positive regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13684.1	CBG13684.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13684	CBG13684		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062445
• Remark: CBG13684, ATTGGTACTGTTCAATTGAGTGTCGGAACGAGGATCAGGACGAAAAACGGAAGAGTGGAA, WBGene00034416
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term