WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00125660 Gene Name  CJA06456
Sequence Name  ? CJA06456 Organism  Caenorhabditis japonica
Biotype  SO:0001217 Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06456a.1 CJA06456a.1   [unknown]
Transcript:CJA06456b.1 CJA06456b.1   [unknown]
Transcript:CJA06456c.1 CJA06456c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06456c CJA06456c   [unknown]
CDS:CJA06456a CJA06456a   [unknown]
CDS:CJA06456b CJA06456b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA06456, AGTGCAAAACTTCTTGAAGAATACCGAGACGAAATTTGGCCGCGATACTGGAACAGTTCG, WBGene00125660   Expr1076886 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term