WormMine: Gene WBGene00136924

• WormBase Gene ID: WBGene00136924
• Gene Name: Cjp-stg-1
• Sequence Name: CJA17720
• Organism: Caenorhabditis japonica
• Automated Description: Is an ortholog of C. elegans stg-1. In C. elegans, stg-1 is involved in positive regulation of glutamatergic synaptic transmission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17720a.1	CJA17720a.1		[unknown]
Transcript:CJA17720b.1	CJA17720b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17720a	CJA17720a		[unknown]
CDS:CJA17720b	CJA17720b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084223
• Remark: Cjp-stg-1, CGTCTCGAAAGAAGTCGGCAACAAAATCCACGCGGCAAGCGAGATGGACGATCCAATGTT, WBGene00136924
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term