WormMine: Gene WBGene00136955

• WormBase Gene ID: WBGene00136955
• Gene Name: CJA17750
• Sequence Name: CJA17750
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Armadillo-type fold and Armadillo-like helical. Is an ortholog of C. elegans Y54H5A.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17750a.1	CJA17750a.1		[unknown]
Transcript:CJA17750b.1	CJA17750b.1		[unknown]
Transcript:CJA17750c.1	CJA17750c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17750a	CJA17750a		[unknown]
CDS:CJA17750b	CJA17750b		[unknown]
CDS:CJA17750c	CJA17750c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086128
• Remark: CJA17750, GTTGCTCAGCTCACAGCAGGAGCACACCCTGCACGCCCTGATCGGCATTTTGATCCGCTA, WBGene00136955
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term