WormMine: Gene WBGene00133767

• WormBase Gene ID: WBGene00133767
• Gene Name: Cjp-sinh-1
• Sequence Name: CJA14563
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: SAPK-interacting protein 1 (Sin1), middle CRIM domain and Sin1, middle CRIM domain. Is an ortholog of C. elegans sinh-1. In C. elegans, sinh-1 is involved in mesendoderm development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14563.1	CJA14563.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14563	CJA14563		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079357
• Remark: Cjp-sinh-1, GAGCCAAATGAGTTCGATTCTGCACGCGCGCGACTCGTCAATCTACAAAGCGTTTTCGCA, WBGene00133767
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term