WormMine: Gene WBGene00060140

• WormBase Gene ID: WBGene00060140
• Gene Name: Cre-toca-1
• Sequence Name: CRE17055
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: SH3 domain; SH3-like domain superfamily; and AH/BAR domain superfamily. Is an ortholog of C. elegans toca-1. In C. elegans, toca-1 is involved in several processes, including negative regulation of protein localization to adherens junction; positive regulation of egg-laying behavior; and regulation of cellular component organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17055.1	CRE17055.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17055	CRE17055		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101502
• Remark: Cre-toca-1, ACCAGAAGTTTTTCGGAAGTGGCAACAATGACAAGAAGGACACTGGAGACTACGGAACTC, WBGene00060140
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term