WormMine: Gene WBGene00061913

• WormBase Gene ID: WBGene00061913
• Gene Name: Cre-nud-1
• Sequence Name: CRE24456
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: N-terminal conserved domain of Nudc.; CS domain; NudC family; HSP20-like chaperone; and NudC N-terminal domain. Is an ortholog of C. elegans nud-1. In C. elegans, nud-1 is involved in several processes, including GABAergic synaptic transmission; chaperone-mediated protein folding; and establishment of organelle localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24456.1	CRE24456.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24456	CRE24456		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1108558
• Remark: Cre-nud-1, GCCGACGTCGGATGAGAAGAAGAAGAATGATATGTTGGCACAGTTCATGAAGCAACACCC, WBGene00061913
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term