WormMine: Gene WBGene00122993

• WormBase Gene ID: WBGene00122993
• Gene Name: Cjp-epg-4
• Sequence Name: CJA03789
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Etoposide-induced 2.4 and Etoposide-induced protein 2.4 (EI24). Is an ortholog of C. elegans epg-4. In C. elegans, epg-4 is involved in macroautophagy and negative regulation of autophagosome assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03789.1	CJA03789.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03789	CJA03789		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075696
• Remark: Cjp-eip-24, AGAAAATCCCGACGATCTCATTTTGTCGTATATCTTACATGCTCACTCAAATGGTGGCAA, WBGene00122993
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term