WormMine: Gene WBGene00063684

• WormBase Gene ID: WBGene00063684
• Gene Name: Cre-lea-1
• Sequence Name: CRE09014
• Organism: Caenorhabditis remanei
• Automated Description: Is an ortholog of C. elegans lea-1. In C. elegans, lea-1 is involved in hyperosmotic response; response to desiccation; and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE09014b.1	CRE09014b.1		[unknown]
Transcript:CRE09014a.2	CRE09014a.2		[unknown]
Transcript:CRE09014a.1	CRE09014a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE09014a	CRE09014a		[unknown]
CDS:CRE09014b	CRE09014b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE

1 Expression Patterns

• Primary Identifier: Expr1101968
• Remark: Cre-lea-1, GGTGAAAAGCTTTCCGATGCATGGGAGGCAACCAAGGACAGAGCCGAAGGAGTCAAGGAA, WBGene00063684
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term