WormMine: Gene WBGene00052884

• WormBase Gene ID: WBGene00052884
• Gene Name: Cre-swan-1
• Sequence Name: CRE05638
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans swan-1. In C. elegans, swan-1 is involved in negative regulation of cell migration; regulation of cellular component organization; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE05638.1	CRE05638.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE05638	CRE05638		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092743
• Remark: Cre-swan-1, TCAAATCCACTGGGGACCAGTTCACAGCAATTGGATCGCAATTTGCTTCAACAAGACTCT, WBGene00052884
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term