WormMine: Gene WBGene00121406

• WormBase Gene ID: WBGene00121406
• Gene Name: CJA02202
• Sequence Name: CJA02202
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Purine 5'-nucleotidase; HAD-like superfamily; HAD superfamily; HAD-superfamily hydrolase, subfamily IG, 5'-nucleotidase; and 5' nucleotidase family. Is an ortholog of C. elegans Y71H10B.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02202.1	CJA02202.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02202	CJA02202		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078758
• Remark: CJA02202, GCTACAACCTTGTGCACTACCCATCATTCTACTATTTCCGCGCTCCAATGAAGTGCATGC, WBGene00121406
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term