WormMine: Gene WBGene00052083

• WormBase Gene ID: WBGene00052083
• Gene Name: Cre-pdf-2
• Sequence Name: CRE00463
• Organism: Caenorhabditis remanei
• Automated Description: Is an ortholog of C. elegans pdf-2. In C. elegans, pdf-2 is involved in several processes, including adenylate cyclase-activating G protein-coupled receptor signaling pathway; locomotory behavior; and parturition.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00463.1	CRE00463.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00463	CRE00463		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113399
• Remark: Cre-nlp-37, CGCTCCACTTAACAAACGAAATAATGCCGAAGTCGTCAACCACATCCTCAAGAACTTCGG, WBGene00052083
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term