WormMine: Gene WBGene00052531

• WormBase Gene ID: WBGene00052531
• Gene Name: Cre-cdr-6
• Sequence Name: CRE27411
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Glutathione S-transferase, C-terminal domain; Thioredoxin-like fold; Glutathione S-transferase N-terminal domain; Glutathione S-transferase, C-terminal domain superfamily; Thioredoxin-like superfamily; and Metaxin, glutathione S-transferase domain. Is an ortholog of C. elegans cdr-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27411.1	CRE27411.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27411	CRE27411		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100602
• Remark: Cre-cdr-6, CCTTGAAAAAGACTTCCCGAAGGTTCTCGAGTACCTTGAACGTATCAGAAAGGAAGTGTA, WBGene00052531
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term