WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00052413 Gene Name  Cre-sem-5.1
Sequence Name  ? CRE27356 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: SH2 domain superfamily; SH3-like domain superfamily; Growth factor receptor-bound protein 2; SH3 domain; and SH2 domain. Is an ortholog of C. elegans sem-5. In C. elegans, sem-5 is involved in several processes, including epidermal growth factor receptor signaling pathway; male genitalia development; and regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE27356.1 CRE27356.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE27356 CRE27356   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE27356, GAACTCACACTATACTGCTGTCTGACATGACTATTGAAGCGAAATTCGTTCAAGCGCTTT, WBGene00052413   Expr1093105 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term