WormMine: Gene WBGene00052495

• WormBase Gene ID: WBGene00052495
• Gene Name: Cre-frm-7
• Sequence Name: CRE27092
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: FERM N-terminal domain; Band 4.1 domain; FERM C-terminal PH-like domain; FERM, C-terminal PH-like domain; FERM, N-terminal; FERM superfamily, second domain; Ubiquitin-like domain superfamily; FERM central domain; and PH-like domain superfamily. Is an ortholog of C. elegans frm-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27092.1	CRE27092.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27092	CRE27092		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101247
• Remark: Cre-frm-7, GATCAATGGATTTTATGTAAATTCTCCAGCTGGAATTCTGTCTCATAACCGAAGACCGTC, WBGene00052495
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term