WormMine: Gene WBGene00052395

• WormBase Gene ID: WBGene00052395
• Gene Name: CRE27344
• Sequence Name: CRE27344
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Low-density lipoprotein (LDL) receptor class A repeat; Low-density lipoprotein receptor domain class A; and LDL receptor-like superfamily. Is an ortholog of C. elegans F58H1.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27344.1	CRE27344.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27344	CRE27344		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106728
• Remark: CRE27344, CTGACCTGTTTGCATCTGAAATGAAATTGGATGATGGAGAGACACAACATATGTTGGAAG, WBGene00052395
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term