WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00132232 Gene Name  Cjp-rund-1
Sequence Name  ? CJA13028 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: RUN domain and RUN domain superfamily. Is an ortholog of C. elegans rund-1. In C. elegans, rund-1 is involved in several processes, including dense core granule maturation; positive regulation of behavior; and regulation of transport. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13028.1 CJA13028.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13028 CJA13028   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA13028, ACTTGAAGACAGGCCGAGAAAACACTGATGCTCCTGTTCGAAAATTGAGTCAGTCTTTTA, WBGene00132232   Expr1086712 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA26498, AGCTGTATACTCTTCTAGAAGACCTGCATAAATACAGCGTTCATTTGCCAGTGGATCTAG, WBGene00182070   Expr1078080 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term