WormMine: Gene WBGene00119822

• WormBase Gene ID: WBGene00119822
• Gene Name: CJA00618
• Sequence Name: CJA00618
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: NAD(P)-binding domain superfamily; Short-chain dehydrogenase/reductase SDR; and Enoyl-(Acyl carrier protein) reductase. Is an ortholog of C. elegans F53C11.3. In C. elegans, F53C11.3 is involved in defense response to Gram-negative bacterium and innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00618.1	CJA00618.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00618	CJA00618		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076155
• Remark: CJA00618, GGACAATAAGAAATGGGAGGACACGGAGAATTTGATTCGTGGACGATCCGGAAAGGGTAA, WBGene00119822
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term