WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119972 Gene Name  CJA00768
Sequence Name  ? CJA00768 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: F-box-like domain superfamily; F-box-like; F-box only protein 33; Leucine-rich repeat domain superfamily; and F-box domain. Is an ortholog of C. elegans T28B4.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00768.1 CJA00768.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00768 CJA00768   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA20974, TGATGACATGGAAACTGATATGCAGGACTTTTTCGCTGACAGTAATCAACCGAATTATGA, WBGene00176546   Expr1081046 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00768, GCGTTGCAGAACAACAGAAATGTGCCGAACTGGATTACTTCACTGCTCTAGGTACTTCAA, WBGene00119972   Expr1088842 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term