WormMine: Gene WBGene00051832

• WormBase Gene ID: WBGene00051832
• Gene Name: Cre-atg-16.1
• Sequence Name: CRE00314
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Autophagy-related protein 16 domain; Autophagy protein 16 (ATG16); G-protein beta WD-40 repeat; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans atg-16.1. In C. elegans, atg-16.1 is involved in aggrephagy.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00314.1	CRE00314.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00314	CRE00314		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113823
• Remark: Cre-atg-16.1, TCCTTATCCTGGAACCCAACTGGATACGGTCTTCTATCTTCAAGCAAGCAAAAAGTTGTG, WBGene00051832
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term