WormMine: Gene WBGene00119238

• WormBase Gene ID: WBGene00119238
• Gene Name: Cjp-cya-1
• Sequence Name: CJA00034
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Cyclin-like; Cyclin; Cyclin, C-terminal domain; Cyclin-like superfamily; Cyclin, N-terminal; and Cyclin, N-terminal domain. Is an ortholog of C. elegans cya-1. In C. elegans, cya-1 is involved in meiotic cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00034a.1	CJA00034a.1		[unknown]
Transcript:CJA00034b.1	CJA00034b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00034a	CJA00034a		[unknown]
CDS:CJA00034b	CJA00034b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072594
• Remark: CJA28233, TTTACACCAAGTATTGCGAGATTGAAGAGCGAGAAGTTGCATTGATTCCAGCGCCAACGA, WBGene00183807
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term