WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00033394 CGC Received  2005-10-03
Genotype  dat-1(ok157) III. Laboratory  CGC
Made By  WBPerson2834 Mutagen  UV+TMP
Name  RM2702 Outcrossed  x6
Remark  Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA Species  Caenorhabditis elegans

1 Alleles

Public Name
ok157

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000934 dat-1 T23G5.5 Caenorhabditis elegans