WormMine: Gene WBGene00051300

• WormBase Gene ID: WBGene00051300
• Gene Name: Cre-vps-52
• Sequence Name: CRE00519
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Vps52 / Sac2 family and Vps52. Is an ortholog of C. elegans vps-52. In C. elegans, vps-52 is involved in negative regulation of dense core granule transport; positive regulation of dense core granule transport; and positive regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00519.1	CRE00519.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00519	CRE00519		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109502
• Remark: Cre-vps-52, ACTTCAACGCAAAGTGGCGGCCTGCTGTGGATAGTATCAATGCTGAATGCATTCAACTTT, WBGene00051300
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term