WormMine: Gene WBGene00051357

• WormBase Gene ID: WBGene00051357
• Gene Name: Cre-lron-7
• Sequence Name: CRE00552
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: BspA type Leucine rich repeat region (6 copies); Leucine-rich repeat; Leucine-rich repeat, typical subtype; BspA type Leucine rich repeat region; Leucine rich repeat; Leucine-rich repeat domain superfamily; and Cysteine-rich flanking region, C-terminal. Is an ortholog of C. elegans lron-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00552.1	CRE00552.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00552	CRE00552		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095006
• Remark: CRE00552, TGGAGGAAACCCATGGAAGTGTGATTGCGACACTCAATTTTTGATGGAAGAGAAATTCGC, WBGene00051357
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term