WormMine: Gene WBGene00051364

• WormBase Gene ID: WBGene00051364
• Gene Name: CRE00084
• Sequence Name: CRE00084
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin E-set; AMP-activated protein kinase, glycogen-binding domain; Immunoglobulin-like fold; Glycogen recognition site of AMP-activated protein kinase; TAR DNA-binding protein 43, N-terminal; and Transactive response DNA-binding protein N-terminal domain. Is an ortholog of C. elegans F46H5.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00084.1	CRE00084.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00084	CRE00084		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1108298
• Remark: CRE00084, GACTACCAACAGGTGCCAAACGGCTTGGGCGGTCAGAACAACGTTATCTTTGTTGAATAA, WBGene00051364
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term