WormMine: Gene WBGene00051369

• WormBase Gene ID: WBGene00051369
• Gene Name: Cre-dnj-7
• Sequence Name: CRE00558
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Chaperone J-domain superfamily; DnaJ domain; Tetratricopeptide repeat; and Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans dnj-7. In C. elegans, dnj-7 is involved in PERK-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00558.1	CRE00558.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00558	CRE00558		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102264
• Remark: Cre-dnj-7, GCTTGCACAGAAATGGCATCCTGACAACTATTCTGATGAGGAGGAGAAGAAGAAGGCCGA, WBGene00051369
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term