WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00051268 Gene Name  CRE00033
Sequence Name  ? CRE00033 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Domain of unknown function DUF38, Caenorhabditis species; F-box A protein FB155/FB224; and FTH domain. Is an ortholog of C. elegans fbxa-48. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE00033.1 CRE00033.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE00033 CRE00033   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE00033, TACGAACGTTGTTAACATTCCAATCAGATTCTTTACACATCTCCACTCTTACAATGCTGA, WBGene00051268   Expr1097395 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term