WormMine: Gene WBGene00025288

• WormBase Gene ID: WBGene00025288
• Gene Name: Cbr-blmp-1
• Sequence Name: CBG02201
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SET domain; Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans blmp-1. In C. elegans, blmp-1 is involved in negative regulation of distal tip cell migration; regulation of developmental process; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02201a.1	CBG02201a.1		[unknown]
Transcript:CBG02201a.2	CBG02201a.2		[unknown]
Transcript:CBG02201b.1	CBG02201b.1		[unknown]
Transcript:CBG02201b.2	CBG02201b.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02201b	CBG02201b		[unknown]
CDS:CBG02201a	CBG02201a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056023
• Remark: Cbr-blmp-1, GCGACGTTTGCGATGCCAAGTTCACTCAATACGTTCATCTGAGACTTCACAAAAGATTGC, WBGene00025288
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term