WormMine: Gene WBGene00214197

• WormBase Gene ID: WBGene00214197
• Gene Name: CJA38350
• Sequence Name: CJA38350
• Organism: Caenorhabditis japonica
• Automated Description: Is an ortholog of C. elegans sbp-1. In C. elegans, sbp-1 is involved in several processes, including cellular response to zinc ion; fatty acid metabolic process; and positive regulation of macromolecule biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA38350.1	CJA38350.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA38350	CJA38350		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083204
• Remark: Cjp-sbp-1, CAGCCGGACGCGTTTCACTTGCACACGCTGGTCAAATTGCACTCAGTTATGGATATTTAA, WBGene00137067
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term