WormMine: Gene WBGene00132254

• WormBase Gene ID: WBGene00132254
• Gene Name: Cjp-smg-6
• Sequence Name: CJA13050
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Tetratricopeptide-like helical domain superfamily; PIN domain; PIN-like domain superfamily; DNA/RNA-binding domain, Est1-type; Telomerase activating protein Est1; Est1 DNA/RNA binding domain; and Telomerase activating protein Est1, N-terminal. Is an ortholog of C. elegans smg-6. In C. elegans, smg-6 is involved in embryonic genitalia morphogenesis; nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; and regulatory ncRNA-mediated post-transcriptional gene silencing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13050.1	CJA13050.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13050	CJA13050		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081582
• Remark: Cjp-smg-6, AAATCGTGTGTCTTGTTAACCGGTGATCGTGGTCTGACGATTAAGGCGGTCGGAAGTCAT, WBGene00132254
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term