WormMine: Gene WBGene00054871

• WormBase Gene ID: WBGene00054871
• Gene Name: CRE25178
• Sequence Name: CRE25178
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: F-box associated and F-box associated domain, type 2. Is an ortholog of C. elegans T22G5.3 and hecw-1. In C. elegans, hecw-1 is involved in regulation of defense response to bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25178.1	CRE25178.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25178	CRE25178		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100568
• Remark: CRE25178, CACCAATTTACTAATGATGATCTCAATGCATTTATGAAACAATGGCTTGAGTCGACTTCC, WBGene00054871
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term