WormMine: Gene WBGene00054774

• WormBase Gene ID: WBGene00054774
• Gene Name: Cre-unc-36
• Sequence Name: CRE25128
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: von Willebrand factor, type A; von Willebrand factor type A domain; von Willebrand factor A-like domain superfamily; and VWA N-terminal. Is an ortholog of C. elegans unc-36. In C. elegans, unc-36 is involved in several processes, including egg-laying behavior; nematode pharyngeal pumping; and serotonin receptor signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25128.1	CRE25128.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25128	CRE25128		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095506
• Remark: Cre-unc-36, TCCATGTCCGAAGCAGTCATCATTCTACTTTTCGAACAAAGATGGAAAGAATAGACCATC, WBGene00054774
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term