WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00215285 Gene Name  CJA39438
Sequence Name  ? CJA39438 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Reverse transcriptase domain; Reverse transcriptase (RNA-dependent DNA polymerase); and DNA/RNA polymerase superfamily. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA39438b.1 CJA39438b.1   [unknown]
Transcript:CJA39438a.1 CJA39438a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA39438b CJA39438b   [unknown]
CDS:CJA39438a CJA39438a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA07006, TCACCAGCCCTCTTCAACTTCTACATAAGAGAAGTGCCAACCATCCCAGGAGCAGAAATA, WBGene00126210   Expr1080906 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term