WormMine: Gene WBGene00054956

• WormBase Gene ID: WBGene00054956
• Gene Name: Cre-ekl-6
• Sequence Name: CRE25513
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: TANGO6/Rtp1; Required for nuclear transport of RNA pol II C-terminus 1; Armadillo-type fold; RNA polymerase II assembly factor Rtp1, C-terminal; and Armadillo-like helical. Is an ortholog of C. elegans ekl-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25513.1	CRE25513.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25513	CRE25513		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098372
• Remark: Cre-ekl-6, CTTCATGCTCAGTTGTGCGTTGAAGAGATCGCTGCAGCTCTCCGTCAGAATCAAGAAGAC, WBGene00054956
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term