WormMine: Gene WBGene00054027

• WormBase Gene ID: WBGene00054027
• Gene Name: CRE26309
• Sequence Name: CRE26309
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: GyrI-like small molecule binding domain and Regulatory factor, effector binding domain superfamily. Is an ortholog of C. elegans T24H7.9. In C. elegans, T24H7.9 is involved in sterol metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26309.1	CRE26309.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26309	CRE26309		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110198
• Remark: CRE26309, GATTCGCATCGTTCTTGGCTCTCGTTTGGTTCACCTACTCCACAATCAGAAAGTACATCA, WBGene00054027
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term