WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054060 Gene Name  Cre-lgg-1
Sequence Name  ? CRE26291 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; Autophagy protein Atg8 ubiquitin-like; and Autophagy protein Atg8 ubiquitin like. Is an ortholog of C. elegans lgg-1. In C. elegans, lgg-1 is involved in several processes, including dauer larval development; positive regulation of autophagosome assembly; and response to stress. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE26291.1 CRE26291.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE26291 CRE26291   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-lgg-1, TGCTGAAGGAGACAAGATTCGCAGAAAGTACCCAGACCGTATTCCAGTTATTGTTGAGAA, WBGene00054060   Expr1102426 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term