WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032651 Gene Name  CBG11546
Sequence Name  ? CBG11546 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Immunoglobulin-like fold and Fibronectin type III superfamily. Is an ortholog of C. elegans C53A5.13. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11546.1 CBG11546.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11546 CBG11546   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG04582, TGAGAGAAGAGAGTTCAATGCATCAGATATGGAAGAGCGAATGCGGTTTCGAGATCATGA, WBGene00027225   Expr1061169 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG11546, AAAGCCAGGAGTTGAAGAATCCGCTCTGATGTACTACCGAAGTGATTCGCCGAATACAAT, WBGene00032651   Expr1057757 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term