WormMine: Gene WBGene00054411

• WormBase Gene ID: WBGene00054411
• Gene Name: Cre-lin-26
• Sequence Name: CRE26374
• Organism: Caenorhabditis remanei
• Automated Description: Is an ortholog of C. elegans lin-26. In C. elegans, lin-26 is involved in several processes, including positive regulation of transcription by RNA polymerase II; tissue development; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26374.1	CRE26374.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26374	CRE26374		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103584
• Remark: Cre-lin-26, ACAGAAACGATTGAGGAAATTGAGCACATTGTGCAGCCACTTCTGAAGATAGAAGCCCCG, WBGene00054411
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term