WormMine: Gene WBGene00054315

• WormBase Gene ID: WBGene00054315
• Gene Name: Cre-mrpl-14
• Sequence Name: CRE26146
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF5522 and Family of unknown function (DUF5522). Is an ortholog of C. elegans mrpl-14.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26146.1	CRE26146.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26146	CRE26146		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109914
• Remark: CRE26146, CGTTGTTTGAAGCCGCTGTCAATAAAGCCAAAGTTCCTTGGGTAAATTACGATGGGTTGA, WBGene00054315
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term