WormMine: Gene WBGene00054188

• WormBase Gene ID: WBGene00054188
• Gene Name: Cre-aff-1
• Sequence Name: CRE26217
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Type I membrane glycoproteins cell-cell fusogen and Cell-cell fusogen EFF/AFF. Is an ortholog of C. elegans aff-1. In C. elegans, aff-1 is involved in regulation of egg-laying behavior and syncytium formation by plasma membrane fusion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26217.1	CRE26217.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26217	CRE26217		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096518
• Remark: Cre-aff-1, GGTTAAAAATGGGAATCCATATCGTAATTGCTGTCGGTCTCCTCTTCCTTTTGATAATTC, WBGene00054188
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term