WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133182 Gene Name  CJA13978
Sequence Name  ? CJA13978 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Pectin lyase fold/virulence factor; Parallel beta-helix repeat; EGF-like domain; Immunoglobulin-like fold; Right handed beta helix domain; Right handed beta helix region; and Pectin lyase fold. Is an ortholog of C. elegans T01D3.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13978.1 CJA13978.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13978 CJA13978   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA13978, TCAACGCGCCAATAGAGCTCAAGAAGGAATGCCCTATGTATTGATGCTACCAACACTGAC, WBGene00133182   Expr1088641 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA26137, GGTGGAAGAAGACGGACAGATCATGGTTCAAGTGTTCATTCAAAATCGTGCGGTATGGAT, WBGene00181709   Expr1080620 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term