WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00125767 Gene Name  Cjp-lgl-1
Sequence Name  ? CJA06563 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Lethal(2) giant larvae protein and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans lgl-1. In C. elegans, lgl-1 is involved in establishment of spindle orientation and protein localization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06563.1 CJA06563.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06563 CJA06563   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA12976, ATACTATTTTCCGTGTTATGCTCGATGCTATGCAACCTGAAACATTGCTTACTAACGAAG, WBGene00132180   Expr1075419 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-lgl-1, AGAGCTACGTCGAACGACCTATTGAAACAAAAACTGATTCAGAAATGCACAATGATCCTC, WBGene00125767   Expr1079270 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term