WormMine: Gene WBGene00053896

• WormBase Gene ID: WBGene00053896
• Gene Name: CRE01567
• Sequence Name: CRE01567
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Hypoxia induced protein conserved region and Hypoxia induced protein, domain. Is an ortholog of C. elegans M05D6.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01567.1	CRE01567.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01567	CRE01567		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1117281
• Remark: CRE01567, TCAAAAGATGATGCAATACCGTATCATGGCTCAATTCTTCACAGTCACTGCACTCGTCGC, WBGene00053896
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term