WormMine: Gene WBGene00062295

• WormBase Gene ID: WBGene00062295
• Gene Name: CRE23879
• Sequence Name: CRE23879
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: AMP-binding enzyme, C-terminal domain; AMP-binding enzyme C-terminal domain; AMP-dependent synthetase/ligase; and AMP-binding enzyme. Is an ortholog of C. elegans C32E8.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE23879.1	CRE23879.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE23879	CRE23879		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105195
• Remark: CRE23879, TGATCGGAAGGATGAAAGAAATGATGAAAGTACGTGGATGGCAAGTGAATCCAAATGAAA, WBGene00062295
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term