WormMine: Gene WBGene00032645

• WormBase Gene ID: WBGene00032645
• Gene Name: Cbr-nuaf-1
• Sequence Name: CBG11538
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: NADH:ubiquinone oxidoreductase intermediate-associated protein 30; Complex I intermediate-associated protein 30, mitochondrial; Galactose-binding-like domain superfamily; and Complex I intermediate-associated protein 30 (CIA30). Is an ortholog of C. elegans nuaf-1. In C. elegans, nuaf-1 is involved in mitochondrial respiratory chain complex I assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11538.1	CBG11538.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11538	CBG11538		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052931
• Remark: CBG11538, ATATTTCAACGAGGGTGCTGAAAGATGGAAGAGTAGAAAGAGCAGGCTGGGCATCCATGA, WBGene00032645
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term